Basically there are four testing approaches for the genealogist to use:
·For the all-male line, the Y-chromosome is tested and this testing is getting more and more sophisticated and more and more powerful.The Y only occurs in males and the test results thus follow the surname.The standard Y-DNA test uses markers called short tandem repeats (or STRs) that are places on the Y where a repeat pattern occurs. (An example would be: CATGCATGCATGCATGCATG with a repeat length of 5.) The number of repeats is measured and reported for each marker tested.Enough replication errors occur during a birth event that a few differences in the number of repeats can be expected within a genealogical time frame.If two men are tested who are descendants of two different sons of a man born 300 years ago their results should match closely and we pretty well know what the results for that man born 300 years ago would have been if we could have tested him.A 37 marker test is typically enough to confirm a known relationship but 67 marker and 111 marker tests are often used to confirm suspected relationships and these tests contain a number of stable markers that are significant for deep ancestry.
·Another type of Y-DNA mutation can occur, but much less frequently – so much less that these are known (mistakenly perhaps) as unique events. This is a change from one nucleotide to another at a specific site on the Y-Chromosome, say a change from C to T. This is called a "single nucleotide polymorphism" or SNP. The chances of this occurring are once in 10,000 to 15,000 transmission events at a specific site but there are so many places on the Y-Chromosome where this can occur that sons are predictably different than their father. These are private SNPs unless they happen in a founder situation, where they are passed down for many generations and become public SNPs.Certain SNPs provide information on ancient male-line ancestry going back thousands of years, separating men into Haplogroups that can be arranged into a timeline called a Haplotree.This type of testing is getting much more thorough and moving into the genealogical time range.The Big Y test, offered by FamilytreeDNA starting in late 2013, used ‘next-generation,’ targeted, non-recombining Y-DNA sequencing of around 11.5 to 12.5 million base pairs to reveal genetic variations across the Y-Chromosome. This was not the most complete test available (Full Genomes Corporation had higher coverage) but covered the most useful sections of the Y at reasonable cost. The result of all this testing was a vast expansion in known SNPs. We have been able to take advantage of this type of testing to put a date on our own British- American Fox connection, a very significant achievement.
·For the all-female line, the mitochondrial DNA (mtDNA) surrounding the cell nucleus can be tested. Both males and females can be tested and both get all of their mitochondrial DNA from their mother and none from their father.There are no STRs to be tested and even though the entire mtDNA molecule can be sequenced, this test is less selective and, of course, the surname changes with each generation.Still, a hypothesis can be tested and a female line Haplogroup can be assigned.
·Several companies offer both males and females a test of about one million specific sites on all their chromosomes where differences between people are known to occur. Again, these are called SNPs and this is known as Autosomal DNA testing.Relatively inexpensive, these tests are becoming very popular but they do have their limitations.Again, one is looking for others with matching results and the link may be any of your ancestors going back as much as 8 to 10 generations.Some relatively close hypothetic relationships can be tested effectively but the matching gets very erratic as the common ancestor gets back more than 4 generations.
The Fox Surname Project
The ideal way of using Y-DNA testing is to have a specific genealogical proposition to test. The results can then indicate whether this proposition is probably true or patently false. Let’s look at some examples from the Fox Surname Project:
The “Desire,” carrying a shipload of Plymouth Friends from Plymouth, England, to Philadelphia in 1686 had a number of Foxes on board. First there was the family of James Fox, co-leader of the expedition, his wife and two sons. Then there were three other Foxes, apprenticed as servants to members of the party. Richard Fox was apprenticed to James Fox. John Fox and Justinian Fox were apprenticed to other members of the party and were not Quakers themselves.
Richard Fox died in 1689 and all the male members of the James Fox family had died by the year 1700. Justinian Fox survived and was the progenitor of a well-known Philadelphia Fox family. He inherited the estate of James Fox. John Fox married and had children but his descendants have never been tracked down.
James was a member of a well-known British Quaker Fox family, which currently has many descendants, living mainly in England. His father, Francis Fox, was born in Devizes, Wiltshire in 1606 and tradition says he was from the same family as Sir Stephen Fox, treasurer to four English Kings.
At about the same time, Henry Fox, a member of another well-known British Fox family had come to Virginia in 1661, married Anne West, a niece of Lord De La Warr, and started a large American Fox family. This family has been traced, by Joseph Steadman, back to another Henry Fox, born in 1521 in Missenden, Buckinghamshire. Project member John William Fox, an anthropology professor, has postulated a name change from Vaux to Fox and proposes to take the family line back to the Norman Invader, Richard de Vaux.
Some members of this Virginia Fox family were named John Fox and Steadman also postulated that a certain John Fox, who had died at the hands of the Cherokee Indians during the Revolutionary War, was a direct descendant of Henry Fox. This John Fox had left a son named Matthew Fox, who was born in Abbeville, SC, in 1766 and moved to Tennessee, where he died in 1854, leaving many descendants.
Finally, a descendant of slaves living in Rutherford County, Tennessee, has been found to be a close match to known Henry Fox/Anne West descendants. Descendants of Andrew Fox of Culpepper, Virginia, lived in close proximity to this slave family.
Question Number 1: Was James Fox bringing along other members of his own family, nephews perhaps? Were all these Foxes truly related?
By Y-DNA STR testing of 4 male line descendants of Francis Fox, father of James Fox, and 4 descendants of Justinian Fox it has been established that Justinian Fox and James Fox were indeed related. Can we say they were first or second cousins, as the paper trail might indicate? This is asking too much of STR testing but we now have Big Y results on two British and two American Foxes that essentially confirm the paper trail.
Question Number 2: Was Steadman correct? Are descendants of Matthew Fox truly related to Henry Fox and Anne West?
We now have tested 7 descendants of Henry Fox and Anne West of Virginia and 4 descendants of Matthew Fox of South Carolina and Tennessee. Steadman was not correct. Surprisingly, the Matthew Fox descendants are of the same family as James and Justinian Fox. Because of their null 439 result, we can confidently say that the Matthew Fox line is not male-line related to the Henry Fox/Anne West Fox line within the last 1,800 years at least.
Question Number 3: Was Matthew Fox a descendant of John Fox, who came over on the ship “Desire” in 1686?
BigY testing has been used to further define the British/American relationships. Four Foxes were tested: 14179, 25481, 16564 and 60400. The latter two, representing Francis Fox descendants, are sixth cousins once removed whose common ancestor was George Fox born in 1693 in Cornwall. England. 14179 represented Justinian Fox descendants and 25481 represented Matthew Fox descendants. When the BigY Results were analyzed, all four matched on 18 SNPs that showed up later than L1/S26. 16564 and 60400 matched each other on just one more SNP. YSEQ has named this A955, a private SNP since these two men are known relatives. 60400 had 3 more private SNPs (singletons)below A955, while 16564 had none. 14179 had 4 singletons, two of which were not found when the BAM file was submitted to Full Genomes for review. 25481 had 7 singleton SNPs.
Significantly, a descendant of a known Fox adoption in about 1850 by a family named Clark in Lycoming County, Pennsylvania, has been found by BigY testing to be a Fox having the same ancestry as the descendant of Matthew Fox of South Carolina. They match on one of 25481's former singletons, which has been named A14367. Since migration in those days was generally from North to South, this is evidence in favor of another related Fox on the ship Desire to Philadelphia in 1686.
16564 and 60400 go back 2 more well-defined generations to Francis Fox born in 1606/1607 in Devizes, Wiltshire. His father has been identified as Henrie Fox and Francis was the seventh son. There is just one SNP (A955) separating 16564 and 60400 from 14179 and 25481. Estimates of average SNP mutation rate range from 100 to 150 years per SNP and Iain MacDonald has found 125 to 135 years per SNP as an average mutation rate for Haplogroup R-U106/S21 BigY results. Subtracting 130 years from 1693 would make 1563 as the as the year the common ancestor of all four was born. Most likely this would have been Henrie Fox. He would thus have been 44 when Francis Fox was born, not a bad estimate since Francis was the seventh son. Assuming that Henrie Fox, father of Francis, is the common ancestor of all four is entirely consistent with the BigY results.
It is certainly possible that ancestors of John Fox migrated southward along with many early Welsh settlers of Philadelphia. Justinian had an elder brother named John. The DNA evidence seems to be pointing to a brotherly connection between the two men on the ship “Desire,” and that Matthew Fox was descended from that John Fox.
Question Number 4: Was Francis Fox indeed related to Sir Stephen Fox?
In 2017 BigY results were obtained for a Fox descendant of the Italy Hollow Fox family of New York State. His ancestor was born in Vermont around the year 1800 and little more is known of his heritage except that these Foxes have tradition that their ancestor knew Sir Stephen Fox's son Henry Fox, Lord Holland, intimately. This Fox matches the others on 7 out of the 10 SNPs they alone have in common, indicating a distant relationship going back to before the year 1200 AD. Can this be the Sir Stephen Fox connection?
Known descendants of Sir Stephen Fox are living today, it is just a matter of getting the proper individual to submit a sample for testing. Not an easy task.
Question Number 5: Was Andrew Fox, whose descendants moved to Rutherford County, Tennessee, related to Henry Fox of Virginia, who married Anne West?
Further STR testing has conclusively proven that Andrew was not related. This was not the ancestor of our slave descendant despite the geographical evidence.
Question Number 6: Was Henry Fox who married Anne West, indeed a descendant of the Norman Invader, Richard de Vaux?
This question could also be answered if known descendants of Richard de Vaux could be located and tested.
A New Haplotree for R-L1/S26
Back in 2004/2005, Leo Little and I were both starting to realize the importance of a null result by FamilytreeDNA (FTDNA) at STR marker DYS 439.It was suspected that a mutation (the scientific terminology is a single nucleotide polymorphism or SNP) in the flank of the marker might be causing the primer to fail to pick up the marker.FTDNA tested Leo, found and gave this SNP the name L1.I was tested by Ethnoancestry (now BritainsDNA) who found and gave this same SNP the name S26.FTDNA’s primer was eventually changed but not before some 200 men with null439 results were identified as candidates for Haplogroup R-L1/S26.
By the end of August, 2015, over 450 men in Haplogroup R-U106/S21, parent of Haplogroup R-L1/S26, were BigY tested in 2014.Nineteen of these men were members of Haplogroup R-L1/S26 and I took on the job of coordinating their results.The variant and coverage files from these tests were analyzed to reveal SNP matches across the entire group plus a dozen or so new SNPs defining phylogenically-significant new subclades as well as a multitude of private SNPs, known as singletons.Insertions and deletions were eliminated from further consideration.This effort was greatly enhanced by a program developed by David Carlisle and amplified by Iain MacDonald of the Haplogroup R-U106/S21 Project Team to reveal SNPs common to all or only a few and detect inconsistent or unreliable SNPs.
The degree of judgment required was significant, especially with regard to singletons, but the team’s analysis was considered very thorough and I confirmed this with my own analysis of the L1/S26 data.Raw data files for several of our group were sent to Full Genomes Corporation for further analysis, basically confirming what we had found.They subtracted as many singletons as they added.
The resulting new Haplotree for R-L1/S26 and its subclades is shown below and the individuals in each subclade are identified.Two new SNPs; S1812 and S1819, appear phylogenically equivalent to L1/S26.Beyond this, 27 new SNPs were found under R-L1/S26, defining ten new subclades.These SNPs were submitted to YSEQ[1] for assessment and validation via Sanger testing and YSEQ assigned the new ones labels starting with the letter A[2].
This haplotree was submitted to Michael Sagar of Familytreedna (FTDNA) in 2017 and he essentially adopted it as his own. Since then FTDNA has adopted a new version of BigY that identifies considerably more variants and Michael Sagar is analyzing the results himself. The tree below is still a valid representation for the participants shown but many more members of the L1/S26 group have been identified and new subclades have been developed.
[1]A company set up by Y-DNA expert Thomas Krahn for this specific purpose.
[2] Several additional SNPs were identified and deemed untestable but may be phylogenetically significant.These were A413 and A414 (Equivalent to A410 and A412) and A672 and A678 in the A671-A679 series